obtaining sequences

[Steven Schmidt]

Jeremy,

this looks good except that I would leave out the blank line between the 
name of the sequence  (>accession.version_start_end) and the sequence itself.

It will be in the next major update of the gramene sequence viewer.

We have the rice genomic sequence in the database.
We could put other sequences in.  We'd probably want to be selective, not
put in all ESTs for all grains.

-Steve


On Monday 08 July 2002 09:52, Jeremy Darwin Edwards wrote:
> Steve,
>
> With regard to the proposed batch sequence extraction feature, I think the
> input should look something like the following, perhaps in an uploadable
> tab-delimited file:
>
> AB023482.2      23683   24028
> AF161269.1      136842  137041
> AP000492.1      25885   26232
>
> The output should be in a single FASTA formatted file as follows:
>  >AB023482.2_23683_24028
>
> GGCTGTGTTTAGTTGGGGAAAAGAAAATTTTTGGGTGTCACATCAGACGTTTGACCGGAT
> GTCGGAAGGGGTTTTTGGACACGAATGAAAAAACTAATTTCAGAACTCGCCTGGAAACCG
> CGAGACGAATCTTTTGAGTCTACTTAAGCCGTCATTAGCACATGTGGGGTTACTGTAGCA
> CTTATGGCTAATCATGGCCTAATTAGGCTCAAAAGATTCGTCTCGCGATTTATAGCTAAA
> CTGTGCAATTGGTTTTTCTTTTTGTCCACATTTAATGCTCCATGCATGTGTCCAAAGATT
> CGATGTGACAGGTGAAGGGGAAAATTTTTGGGAACTAAACTAGCCC
>
>  >AF161269.1_136842_137041
>
> GGCCTAATTAGTACATGATTAGCCATAATTGCTACAATAACCCACATGTGCTAATGACGGATTAATTAGGTTCAA
>AAGATTCGTCTCGCGGTTTCCAGACGAGTTATGAAATTAGTTTTTTCATTCGTCTCCGAAAACTCCTTCCGGTTAA
>ACATCCGATGTGACACCCAAATTTTTTTTTTCGCGAACTAAATAGGCCC
>
>  >AP000492.1_25885_26232
>
> GGCCCCGTTTAGTTCCCCAAAATTTTTTCTCAAAAACATCACATCGAATCTTTGGACACATGCACAAAACATTAA
>ATATAGATAAATGAAAAAACTAATTGCACAGTTAGGGATGAAATCGCGAGACAAATCTTTTGAGCATAATTAGTCC
>ATGATTAGCCATAAAGTGCTATAGTAACCCACATGTGCTAATGACGGATTAATTAGGCTCAAAAGATCCGTCTCGC
>GGTTTCCAGACGAGTTATGAAAATATTTTTTTTTCATTCGTGTCCGAAAAGCCCTTCCGACATCCGGTCAAACATC
>CAATGTGACACTCTAAATTTTTCTTTTCTCGAACTAAACAGGCCC
>
> I realize that Gramene doesn't currently keep sequences, but it might be a
> good idea to at least keep a current copy of the rice genome
> sequence.   This will be a nice feature for users to extract multiple
> sequences corresponding to their query results.  If this batch sequence
> extraction feature is implemented, I'm sure that it will very popular.
>
> Jeremy Edwards
>
> At 08:34 AM 7/8/2002 -0400, you wrote:
> >I support this idea.
> >
> >Lincoln
> >
> >On Thursday 27 June 2002 04:09 pm, jde22 at cornell.edu wrote:
> > > I have an idea for Gramene that I think will be very useful for many
> > > users.  It would be great if there was a way to download specific
> > > pieces of sequences by submitting a list of BACs
> > > (or any other sequences) and regions within those sequences.  So, the
> > > user would specify the BAC and the beginning and end of the sequences
> > > of interest and the sequences would be returned, perhaps in FASTA
> > > format. This is something that Genbank should do, but doesn't, and most
> > > of us spend too much time cutting out the sequences that we want.  A
> > > batch option would also be really great.  I typically write scripts and
> > > have a few other tricks to do this, but for the typical user, it is a
> > > real chore.
> > >
> > > Jeremy Edwards
> >
> >--
> >========================================================================
> >Lincoln D. Stein                           Cold Spring Harbor Laboratory
> >lstein at cshl.org                                   Cold Spring Harbor, NY
> >========================================================================

-- 
Steven Schmidt
www.gramene.org
Cold Spring Harbor Laboratory
516-367-6977