obtaining sequences

[Jeremy Darwin Edwards]

Steve,

With regard to the proposed batch sequence extraction feature, I think the 
input should look something like the following, perhaps in an uploadable 
tab-delimited file:

AB023482.2      23683   24028
AF161269.1      136842  137041
AP000492.1      25885   26232

The output should be in a single FASTA formatted file as follows:

 >AB023482.2_23683_24028
GGCTGTGTTTAGTTGGGGAAAAGAAAATTTTTGGGTGTCACATCAGACGTTTGACCGGAT 
GTCGGAAGGGGTTTTTGGACACGAATGAAAAAACTAATTTCAGAACTCGCCTGGAAACCG 
CGAGACGAATCTTTTGAGTCTACTTAAGCCGTCATTAGCACATGTGGGGTTACTGTAGCA 
CTTATGGCTAATCATGGCCTAATTAGGCTCAAAAGATTCGTCTCGCGATTTATAGCTAAA 
CTGTGCAATTGGTTTTTCTTTTTGTCCACATTTAATGCTCCATGCATGTGTCCAAAGATT 
CGATGTGACAGGTGAAGGGGAAAATTTTTGGGAACTAAACTAGCCC

 >AF161269.1_136842_137041
GGCCTAATTAGTACATGATTAGCCATAATTGCTACAATAACCCACATGTGCTAATGACGGATTAATTAGGTTCAAAAGATTCGTCTCGCGGTTTCCAGACGAGTTATGAAATTAGTTTTTTCATTCGTCTCCGAAAACTCCTTCCGGTTAAACATCCGATGTGACACCCAAATTTTTTTTTTCGCGAACTAAATAGGCCC

 >AP000492.1_25885_26232
GGCCCCGTTTAGTTCCCCAAAATTTTTTCTCAAAAACATCACATCGAATCTTTGGACACATGCACAAAACATTAAATATAGATAAATGAAAAAACTAATTGCACAGTTAGGGATGAAATCGCGAGACAAATCTTTTGAGCATAATTAGTCCATGATTAGCCATAAAGTGCTATAGTAACCCACATGTGCTAATGACGGATTAATTAGGCTCAAAAGATCCGTCTCGCGGTTTCCAGACGAGTTATGAAAATATTTTTTTTTCATTCGTGTCCGAAAAGCCCTTCCGACATCCGGTCAAACATCCAATGTGACACTCTAAATTTTTCTTTTCTCGAACTAAACAGGCCC

I realize that Gramene doesn't currently keep sequences, but it might be a 
good idea to at least keep a current copy of the rice genome 
sequence.   This will be a nice feature for users to extract multiple 
sequences corresponding to their query results.  If this batch sequence 
extraction feature is implemented, I'm sure that it will very popular.

Jeremy Edwards



At 08:34 AM 7/8/2002 -0400, you wrote:
>I support this idea.
>
>Lincoln
>
>On Thursday 27 June 2002 04:09 pm, jde22 at cornell.edu wrote:
> > I have an idea for Gramene that I think will be very useful for many
> > users.  It would be great if there was a way to download specific
> > pieces of sequences by submitting a list of BACs
> > (or any other sequences) and regions within those sequences.  So, the
> > user would specify the BAC and the beginning and end of the sequences of
> > interest and the sequences would be returned, perhaps in FASTA format.
> > This is something that Genbank should do, but doesn't, and most of us spend
> > too much time cutting out the sequences that we want.  A batch option would
> > also be really great.  I typically write scripts and have a few other
> > tricks to do this, but for the typical user, it is a real chore.
> >
> > Jeremy Edwards
>
>--
>========================================================================
>Lincoln D. Stein                           Cold Spring Harbor Laboratory
>lstein at cshl.org                                   Cold Spring Harbor, NY
>========================================================================