[Gmod-help] Re: [Gmod-schema] Apollo and Chado problems
J.M.P. Alves
jmalves at vcu.edu
Fri Dec 18 16:40:45 EST 2009
Hi,
Thanks for the explanation.
In the meantime, I was analyzing the chado schema (using an interesting
tool called SchemaSpy) and saw the following possible anomalies:
Columns that are flagged as both 'nullable' and 'must be unique':
Column
acquisition.name
assay.name
biomaterial.name
featuremap.name
materialized_view.name
5 instances of anomaly detected
I don't know if the tool is correct in the assessment that this is
wrong, but a column needing to be unique and at the same time being
allowed to be null is something that could potentially cause a problem.
So I'm letting you know just in case. ;-)
Cheers
J
Scott Cain wrote:
> Hi J,
>
> I just wanted to let you know that I've been working on this. There
> are actually two bugs that your experience have pointed out.
>
> 1. The way that Bio::FeatureIO::gff and Bio::SeqIO::fasta interact
> causes the first sequence in a GFF or fasta file to be lost.
> a. A work around for this bug has been committed to
> gmod_gff3_preprocessor.pl so that fasta files created by it won't be
> affected anymore.
> b. I'm working on actually fixing Bio::FeatureIO::gff (which is
> where the real bug is), but boy did we write some arcane code for that
> :-)
>
> 2. When I modified the bulk loader in the last few weeks (making it
> really much better :-) I broke the ability to load a fasta file
> separately as though it were a GFF3 file. Because I think that is
> nice functionality to have, I will either restore that functionality,
> or add a --fasta option (whichever turns out to be easier).
>
> Scott
>
>
> On Thu, Dec 10, 2009 at 5:03 PM, J.M.P. Alves <jmalves at vcu.edu> wrote:
>> OK, after quite a bit of poking around the code and DB (sorry, I'm new to
>> GMOD, Chado AND PostgreSQL...), I seem to have solved my problem with the
>> loading of sequences to the database from GFF. At least now GBrowse is
>> working perfectly, and Apollo can also load the sequence fine.
>>
>> Here goes my solution, in case other people out there face the same problem
>> -- and please let me know if I'm doing it wrong...
>>
>> First, the quick answer:
>> - after using gmod_gff_preprocessor.pl as described in the Wiki and getting
>> two files (one with annotations in GFF, the other with sequence), use 'cat'
>> to join them (I added the sorted GFF part first, the sequence part second),
>> like:
>>
>> cat yeast.gff.sorted yeast.gff.sorted.fasta > yeast_all.gff
>>
>> - upload the resulting joined file, like this:
>>
>> gmod_bulk_load_gff3.pl --organism yeast --gfffile yeast_all.gff
>>
>> Maybe --nosplit to the preprocessor would solve this too, but I haven't
>> tried.
>>
>>
>>
>> Now, as is my bad habit, for the long answer.
>>
>> I was having trouble loading the sequence when following the instructions
>> from http://gmod.org/wiki/Load_GFF_Into_Chado plus what the perldoc from
>> gmod_gff_preprocessor.pl told me:
>>
>> [quote]
>> If the GFF3 file contains FASTA sequence at the end, the sequence will be
>> placed in a separate file with the extention '.fasta'. This fasta file can
>> be loaded separately after the split and/or
>> sorted GFF3 files are loaded, using the command:
>>
>> gmod_bulk_load_gff3.pl -g <fasta file name>
>> [/quote]
>>
>> Well, so that's exactly what I did, and got the ugly errors I pasted in the
>> earlier message.
>>
>> Problem is that the current version of gmod_bulk_load_gff3.pl does NOT seem
>> to have a -g option for loading the sequences as described in the
>> preprocessor's documentation -- and as I believe GetOptions does, it is
>> interpreting -g as short for --gfffile.
>>
>> Looking at the code, gmod_bulk_load_gff3.pl seems to create a temporary
>> table (tmp_gff_load_cache) during loading of the annotation that seems to no
>> longer exist (or contain the necessary data, at least) in a second run of
>> the program. I think.
>>
>> Either way, joining the two files output by gmod_gff_preprocessor.pl
>> resulted in the sequence finally being uploaded fine.
>>
>> So the documentation from both gmod_gff_preprocessor.pl and
>> http://gmod.org/wiki/Load_GFF_Into_Chado should be changed accordingly when
>> possible. Unless I'm the only bone-headed person who's interpreted things
>> the way I have. :-)
>>
>> Cheers
>> J
>>
>> J.M.P. Alves wrote:
>>> Thanks. I noticed that when I accessed GBrowse and saw the display.
>>>
>>> But another problem happened when I tried to load the sequence (file
>>> generated by gmod_gff3_preprocessor.pl), as listed below. I had already
>>> loaded the file other file generated by the preprocessor, and the only
>>> possibly suspicious things in the output where two skipped tables:
>>>
>>> Skipping cv table since the load file is empty...
>>> Loading data into analysis table ...
>>> Skipping organism table since the load file is empty...
>>>
>>> I'm guessing that the organism table warning is not a problem, given I
>>> provided the --organism option. Is the second table, cv, the problem here?
>>>
>>> The sequence file looks almost completely like a regular FASTA file,
>>> except for the very top, which looks like:
>>>
>>> ##FASTA
>>> ##FASTA
>>> >chrI
>>>
>>> CCACACCACACCCACACACCCACACACCACACCACACACCACACCACACCCACACACACACATCCTAACACTACCCTAAC
>>>
>>> ACAGCCCTAATCTAACCCTGGCCAACCTGTCTCTCAACTTACCCTCCATTACCCTGCCTCCACTCGTTACCCTGTCCCAT
>>>
>>> This did not happen with the previous version of the schema and GMOD
>>> software an general, as far as I can tell (sure did not get the error when
>>> loading, can't remember whether I tried to access the sequence from GBrowse
>>> at the time of those tests)
>>>
>>> Thanks for your help
>>> J
>>>
>>> ===================================================
>>> gmod_bulk_load_gff3.pl --organism yeast -g
>>> saccharomyces_cerevisiae.gff.sorted.fasta
>>> Preparing data for inserting into the mas_chado database
>>> (This may take a while ...)
>>> No feature found for
>>> CCACACCACACCCACACACCCACACACCACACCACACACCACACCACACCCACACACACACATCCTAACACTACCCTAAC,
>>> org_id:10 when trying to add sequence at
>>> /usr/local/share/perl/5.10.0/Bio/GMOD/DB/Adapter.pm line 2479, <GEN0> line
>>> 4.
>>> No feature found for chrII, org_id:10 when trying to add sequence at
>>> /usr/local/share/perl/5.10.0/Bio/GMOD/DB/Adapter.pm line 2479, <GEN0> line
>>> 5.
>>> No feature found for chrIII, org_id:10 when trying to add sequence at
>>> /usr/local/share/perl/5.10.0/Bio/GMOD/DB/Adapter.pm line 2479, <GEN0> line
>>> 6.
>>> No feature found for chrIV, org_id:10 when trying to add sequence at
>>> /usr/local/share/perl/5.10.0/Bio/GMOD/DB/Adapter.pm line 2479, <GEN0> line
>>> 7.
>>> No feature found for chrV, org_id:10 when trying to add sequence at
>>> /usr/local/share/perl/5.10.0/Bio/GMOD/DB/Adapter.pm line 2479, <GEN0> line
>>> 8.
>>> No feature found for chrVI, org_id:10 when trying to add sequence at
>>> /usr/local/share/perl/5.10.0/Bio/GMOD/DB/Adapter.pm line 2479, <GEN0> line
>>> 9.
>>> No feature found for chrVII, org_id:10 when trying to add sequence at
>>> /usr/local/share/perl/5.10.0/Bio/GMOD/DB/Adapter.pm line 2479, <GEN0> line
>>> 10.
>>> No feature found for chrVIII, org_id:10 when trying to add sequence at
>>> /usr/local/share/perl/5.10.0/Bio/GMOD/DB/Adapter.pm line 2479, <GEN0> line
>>> 11.
>>> No feature found for chrIX, org_id:10 when trying to add sequence at
>>> /usr/local/share/perl/5.10.0/Bio/GMOD/DB/Adapter.pm line 2479, <GEN0> line
>>> 12.
>>> No feature found for chrX, org_id:10 when trying to add sequence at
>>> /usr/local/share/perl/5.10.0/Bio/GMOD/DB/Adapter.pm line 2479, <GEN0> line
>>> 13.
>>> No feature found for chrXI, org_id:10 when trying to add sequence at
>>> /usr/local/share/perl/5.10.0/Bio/GMOD/DB/Adapter.pm line 2479, <GEN0> line
>>> 14.
>>> No feature found for chrXII, org_id:10 when trying to add sequence at
>>> /usr/local/share/perl/5.10.0/Bio/GMOD/DB/Adapter.pm line 2479, <GEN0> line
>>> 15.
>>> No feature found for chrXIII, org_id:10 when trying to add sequence at
>>> /usr/local/share/perl/5.10.0/Bio/GMOD/DB/Adapter.pm line 2479, <GEN0> line
>>> 16.
>>> No feature found for chrXIV, org_id:10 when trying to add sequence at
>>> /usr/local/share/perl/5.10.0/Bio/GMOD/DB/Adapter.pm line 2479, <GEN0> line
>>> 17.
>>> No feature found for chrXV, org_id:10 when trying to add sequence at
>>> /usr/local/share/perl/5.10.0/Bio/GMOD/DB/Adapter.pm line 2479, <GEN0> line
>>> 18.
>>> No feature found for chrXVI, org_id:10 when trying to add sequence at
>>> /usr/local/share/perl/5.10.0/Bio/GMOD/DB/Adapter.pm line 2479, <GEN0> line
>>> 19.
>>> No feature found for chrMito, org_id:10 when trying to add sequence at
>>> /usr/local/share/perl/5.10.0/Bio/GMOD/DB/Adapter.pm line 2479, <GEN0> line
>>> 20.
>>> No feature found for 2-micron, org_id:10 when trying to add sequence at
>>> /usr/local/share/perl/5.10.0/Bio/GMOD/DB/Adapter.pm line 2479, <GEN0> line
>>> 21.
>>> Skipping feature table since the load file is empty...
>>> Skipping featureloc table since the load file is empty...
>>> Skipping feature_relationship table since the load file is empty...
>>> Skipping featureprop table since the load file is empty...
>>> Skipping feature_cvterm table since the load file is empty...
>>> Skipping synonym table since the load file is empty...
>>> Skipping feature_synonym table since the load file is empty...
>>> Skipping dbxref table since the load file is empty...
>>> Skipping feature_dbxref table since the load file is empty...
>>> Skipping analysisfeature table since the load file is empty...
>>> Skipping cvterm table since the load file is empty...
>>> Skipping db table since the load file is empty...
>>> Skipping cv table since the load file is empty...
>>> Skipping analysis table since the load file is empty...
>>> Skipping organism table since the load file is empty...
>>> Loading sequences (if any) ...
>>>
>>> Done.
>>>
>>> While this script has made an effort to optimize the database, you
>>> should probably also run VACUUM FULL ANALYZE on the database as well
>>> commit ineffective with AutoCommit enabled at
>>> /usr/local/share/perl/5.10.0/Bio/GMOD/DB/Adapter.pm line 1349.
>>> ===================================================
>>>
>>>
>>>
>>>
>>> Scott Cain wrote:
>>>> That's not a problem. That was just introduced to the codebase within
>>>> the last few weeks and I need to fix it, but it is calling a commit at
>>>> the end of the load when it isn't needed.
>>>>
>>>> Scott
>>>>
>>>> On Thu, Dec 3, 2009 at 5:46 PM, J.M.P. Alves <jmalves at vcu.edu> wrote:
>>>>> Hi,
>>>>>
>>>>> At the end of loading the GFF file (using gmod_bulk_load_gff3.pl) into
>>>>> Chado, I get something I did not get before:
>>>>>
>>>>> commit ineffective with AutoCommit enabled
>>>>>
>>>>> Is that just a warning and the data was loaded anyway, or does it mean
>>>>> the
>>>>> commit failed? If I knew the schema better, I could check some tables,
>>>>> but
>>>>> there are so many...
>>>>>
>>>>> Thanks
>>>>> J
>>>>>
>>>>> Scott Cain wrote:
>>>>>> Hi J,
>>>>>>
>>>>>> Yes, getting schema/trunk is sufficient. Since we moved to svn pretty
>>>>>> recently, there are likely to be other holes in documentation where
>>>>>> cvs was assumed.
>>>>>>
>>>>>> As for further questions, it depends on what they are concerning. If
>>>>>> apollo webstart is causing you problems, you can ask about it on the
>>>>>> apollo mailing list, GBrowse questions to the gbrowse list, and most
>>>>>> other questions would go to the schema mailing list.
>>>>>>
>>>>>> Scott
>>>>>>
>>>>>> On Thu, Dec 3, 2009 at 12:15 PM, J.M.P. Alves <jmalves at vcu.edu> wrote:
>>>>>>> Hi,
>>>>>>>
>>>>>>> Thanks for the answer, that helped. I was following the instructions
>>>>>>> from
>>>>>>> http://gmod.org/wiki/Chado_-_Getting_Started but I missed the part
>>>>>>> about
>>>>>>> ant
>>>>>>> (because I was originally not installing from SVN) -- have that
>>>>>>> installed
>>>>>>> now. I didn't see anything about the checking out of the whole schema
>>>>>>> though.
>>>>>>>
>>>>>>> What I did was this:
>>>>>>>
>>>>>>> svn co https://gmod.svn.sourceforge.net/svnroot/gmod/schema/trunk
>>>>>>>
>>>>>>> It does check out GMODTools and other stuff. Is that sufficient? It
>>>>>>> did
>>>>>>> take
>>>>>>> care of all the errors at any rate.
>>>>>>>
>>>>>>> I'm now loading the ontologies into my database, and will next load
>>>>>>> the
>>>>>>> S.
>>>>>>> cerevisiae GFF into the DB for testing (as described at
>>>>>>> http://gmod.org/wiki/Load_GFF_Into_Chado).
>>>>>>>
>>>>>>> Thanks again
>>>>>>> J
>>>>>>>
>>>>>>> PS: quick question, I'm using the community annotation server (VMware
>>>>>>> image
>>>>>>> available from http://gmod.org/wiki/Community_Annotation_System) you
>>>>>>> have,
>>>>>>> and it's mostly working (webstarted Apollo is giving a little
>>>>>>> trouble). I
>>>>>>> do
>>>>>>> have some problems and questions about it though. Which list should I
>>>>>>> direct
>>>>>>> them to?
>>>>>>>
>>>>>>>
>>>>>>> Scott Cain wrote:
>>>>>>>> Hi J,
>>>>>>>>
>>>>>>>> I don't know how I missed a few emails in this thread, but the
>>>>>>>> problem
>>>>>>>> you are having is because you need to checkout the entire schema
>>>>>>>> repository, not just the chado subdirectory. You must have ant
>>>>>>>> installed, and you need to have the GMODTools directory, which is at
>>>>>>>> the same level as the chado directory.
>>>>>>>>
>>>>>>>> Scott
>>>>>>>>
>>>>>>>>
>>>>>>>> On Wed, Dec 2, 2009 at 4:11 PM, J.M.P. Alves <jmalves at vcu.edu> wrote:
>>>>>>>>> Hi, Dave
>>>>>>>>>
>>>>>>>>> Thanks, that did help -- although the two lines you mention were
>>>>>>>>> *already*
>>>>>>>>> commented out. I also had to comment out the following:
>>>>>>>>>
>>>>>>>>> if ($ant or !-e "$working_dir/../GMODTools") {
>>>>>>>>> push @exe_files, 'bin/gmod_bulkfiles.pl',
>>>>>>>>> 'bin/gmod_gff2biomart5.pl';
>>>>>>>>> }
>>>>>>>>>
>>>>>>>>> These are currently lines 493-5 of Makefile.PL
>>>>>>>>>
>>>>>>>>> After that, it did finish without problems, apparently.
>>>>>>>>>
>>>>>>>>> I am currently updating from the gmod-1.0 file found on SourceForge
>>>>>>>>> to
>>>>>>>>> the
>>>>>>>>> SVN code. Do I need to uninstall the old version (how? 'make
>>>>>>>>> uninstall'
>>>>>>>>> does
>>>>>>>>> not do it, just gives a list of things to delete) or is just
>>>>>>>>> installing
>>>>>>>>> on
>>>>>>>>> top of the one I have right now fine?
>>>>>>>>>
>>>>>>>>> Thanks
>>>>>>>>> J
>>>>>>>>>
>>>>>>>>> Dave Clements, GMOD Help Desk wrote:
>>>>>>>>>> Hi J,
>>>>>>>>>>
>>>>>>>>>> We generally recommend searching using Nabble:
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>>>> http://www.nabble.com/Generic-Model-Organism-System-Database-f3491.html
>>>>>>>>>>
>>>>>>>>>> And, using Nabble, I found a thread from 2007
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>>>> (http://old.nabble.com/Blast-input-file-for-CHADO-to9828403.html#a9847174)
>>>>>>>>>> where someone had the same problem. I have no idea why you are
>>>>>>>>>> having
>>>>>>>>>> the problem, but a workaround is:
>>>>>>>>>>
>>>>>>>>>> But, it works after commenting out the following lines in
>>>>>>>>>> Makefile.PL.
>>>>>>>>>> #'bin/gmod_bulkfiles.pl', line no 522
>>>>>>>>>> #'bin/gmod_gff2biomart5.pl', line no 523
>>>>>>>>>>
>>>>>>>>>> You don't need the biomart script unless you are using BioMart too.
>>>>>>>>>> Does that work for you?
>>>>>>>>>>
>>>>>>>>>> Dave C.
>>>>>>>>>>
>>>>>>>>>> On Mon, Nov 30, 2009 at 1:44 PM, J.M.P. Alves <jmalves at vcu.edu>
>>>>>>>>>> wrote:
>>>>>>>>>>> Thanks, Scott
>>>>>>>>>>>
>>>>>>>>>>> I just subscribed to the list. BTW, is there a way to search it? I
>>>>>>>>>>> looked there, but the Sourceforge interface is terrible, and the
>>>>>>>>>>> search
>>>>>>>>>>> box on the top right searches all the site's project names instead
>>>>>>>>>>> of
>>>>>>>>>>> the list archives.
>>>>>>>>>>>
>>>>>>>>>>> I ask because, following your advice, I checked out the svn
>>>>>>>>>>> version.
>>>>>>>>>>> Then I got a warning during perl Makefile.PL that the kit was
>>>>>>>>>>> missing
>>>>>>>>>>> files, contact author:
>>>>>>>>>>>
>>>>>>>>>>> ===========================================
>>>>>>>>>>> Checking if your kit is complete...
>>>>>>>>>>> Warning: the following files are missing in your kit:
>>>>>>>>>>> bin/cxgn/load_cvterms.pl
>>>>>>>>>>> bin/gmod_bulkfiles.pl
>>>>>>>>>>> bin/gmod_gff2biomart5.pl
>>>>>>>>>>> conf/bulkfiles/anogam.xml
>>>>>>>>>>> conf/bulkfiles/blastfiles.xml
>>>>>>>>>>> conf/bulkfiles/bulkfiles_template.xml
>>>>>>>>>>> conf/bulkfiles/chadofeatconv.xml
>>>>>>>>>>> conf/bulkfiles/chadofeatsql.xml
>>>>>>>>>>> conf/bulkfiles/chadogenepagesql.xml
>>>>>>>>>>> conf/bulkfiles/dmelhetfeatconv.xml
>>>>>>>>>>> conf/bulkfiles/dmelr420.xml
>>>>>>>>>>> conf/bulkfiles/dmelr430.xml
>>>>>>>>>>> conf/bulkfiles/dpsebulk-p4.xml
>>>>>>>>>>> conf/bulkfiles/dpsebulk-p5.xml
>>>>>>>>>>> conf/bulkfiles/dpsebulk-r2.xml
>>>>>>>>>>> conf/bulkfiles/drosmelgb.xml
>>>>>>>>>>> conf/bulkfiles/fastawriter.xml
>>>>>>>>>>> conf/bulkfiles/fbbulk-hetr3.xml
>>>>>>>>>>> conf/bulkfiles/fbbulk-r3.xml
>>>>>>>>>>> conf/bulkfiles/fbbulk-r3h.xml
>>>>>>>>>>> conf/bulkfiles/fbbulk-r4.xml
>>>>>>>>>>> conf/bulkfiles/fbbulk-r41.xml
>>>>>>>>>>> conf/bulkfiles/fbbulk-r411.xml
>>>>>>>>>>> conf/bulkfiles/fbreleases.xml
>>>>>>>>>>> conf/bulkfiles/featuresets.xml
>>>>>>>>>>> conf/bulkfiles/filesets.xml
>>>>>>>>>>> conf/bulkfiles/gbrowseconf.xml
>>>>>>>>>>> conf/bulkfiles/gbrowseconf_fb.xml
>>>>>>>>>>> conf/bulkfiles/genbanksubmit.xml
>>>>>>>>>>> conf/bulkfiles/genomeweb.xml
>>>>>>>>>>> conf/bulkfiles/organisms.xml
>>>>>>>>>>> conf/bulkfiles/sgdbulk.xml
>>>>>>>>>>> conf/bulkfiles/sgdbulk1.xml
>>>>>>>>>>> conf/bulkfiles/sgdfeatconf.xml
>>>>>>>>>>> conf/bulkfiles/site_defaults.xml
>>>>>>>>>>> conf/bulkfiles/site_eugenes_defaults.xml
>>>>>>>>>>> conf/bulkfiles/spbase.xml
>>>>>>>>>>> conf/bulkfiles/spbasefeatconf.xml
>>>>>>>>>>> conf/bulkfiles/tablewriter.xml
>>>>>>>>>>> conf/bulkfiles/toacode.xml
>>>>>>>>>>> conf/bulkfiles/tognomap.xml
>>>>>>>>>>> conf/chado2apollo-apache.conf
>>>>>>>>>>> doc/about-gff2biomart.pod
>>>>>>>>>>> doc/COPYRIGHT
>>>>>>>>>>> doc/gff2biomart-update.note
>>>>>>>>>>> doc/gmod-tools-readme.pod
>>>>>>>>>>> lib/Bio/GMOD/Bulkfiles.pm
>>>>>>>>>>> lib/Bio/GMOD/Bulkfiles/AcodeWriter.pm
>>>>>>>>>>> lib/Bio/GMOD/Bulkfiles/BlastWriter.pm
>>>>>>>>>>> lib/Bio/GMOD/Bulkfiles/BulkWriter.pm
>>>>>>>>>>> lib/Bio/GMOD/Bulkfiles/FastaWriter.pm
>>>>>>>>>>> lib/Bio/GMOD/Bulkfiles/FeatureWriter.pm
>>>>>>>>>>> lib/Bio/GMOD/Bulkfiles/GenbankSubmitWriter.pm
>>>>>>>>>>> lib/Bio/GMOD/Bulkfiles/GnomapWriter.pm
>>>>>>>>>>> lib/Bio/GMOD/Bulkfiles/MyLargePrimarySeq.pm
>>>>>>>>>>> lib/Bio/GMOD/Bulkfiles/MySplitLocation.pm
>>>>>>>>>>> lib/Bio/GMOD/Bulkfiles/SWISS_CRC64.pm
>>>>>>>>>>> lib/Bio/GMOD/Bulkfiles/TableWriter.pm
>>>>>>>>>>> lib/Bio/GMOD/Config2.pm
>>>>>>>>>>> lib/Bio/GMOD/SeqUtils.pm
>>>>>>>>>>> Please inform the author.
>>>>>>>>>>> ===========================================
>>>>>>>>>>>
>>>>>>>>>>> When I "make", it finishes quite early, with:
>>>>>>>>>>>
>>>>>>>>>>> make: *** No rule to make target `bin/gmod_gff2biomart5.pl',
>>>>>>>>>>> needed
>>>>>>>>>>> by
>>>>>>>>>>> `blib/script/gmod_gff2biomart5.pl'. Stop.
>>>>>>>>>>>
>>>>>>>>>>> (the full output of "make" is below)
>>>>>>>>>>>
>>>>>>>>>>> Has anyone seen this problem? Is it a problem? (it seems to me...)
>>>>>>>>>>> And
>>>>>>>>>>> any idea what to do, please?
>>>>>>>>>>>
>>>>>>>>>>> Thanks
>>>>>>>>>>> J
>>>>>>>>>>>
>>>>>>>>>>> ===========================================
>>>>>>>>>>> ~/prog/chado$ make
>>>>>>>>>>> Skip blib/lib/Bio/GMOD/Load.pm (unchanged)
>>>>>>>>>>> Skip blib/lib/Bio/FeatureIO/chado.pm (unchanged)
>>>>>>>>>>> Skip blib/lib/Bio/GMOD/DB/Config.pm (unchanged)
>>>>>>>>>>> Skip blib/lib/Bio/Chado/Config.pm (unchanged)
>>>>>>>>>>> Skip blib/lib/Bio/Chado/LoadDBI.pm (unchanged)
>>>>>>>>>>> Skip blib/lib/Bio/GMOD/Load/GFF.pm (unchanged)
>>>>>>>>>>> Skip blib/lib/Bio/GMOD/Config.pm (unchanged)
>>>>>>>>>>> Skip blib/lib/Bio/FeatureIO/chadobulk.pm (unchanged)
>>>>>>>>>>> Skip blib/lib/Bio/GMOD/DB/Adapter.pm (unchanged)
>>>>>>>>>>> Skip blib/lib/Bio/GMOD/DB/Adapter/Wormbase.pm (unchanged)
>>>>>>>>>>> Skip blib/lib/Bio/Chado/AutoDBI.pm (unchanged)
>>>>>>>>>>> Skip blib/lib/Bio/GMOD/DB/Adapter/FeatureIterator.pm (unchanged)
>>>>>>>>>>> Skip blib/lib/Bio/GMOD/DB/Tools/ETA.pm (unchanged)
>>>>>>>>>>> Skip blib/lib/Bio/Chado/Builder.pm (unchanged)
>>>>>>>>>>> make[1]: Entering directory `/home/jmalves/prog/chado/chaos-xml'
>>>>>>>>>>> cp lib/Bio/Chaos/ChaosGraph.pm ../blib/lib/Bio/Chaos/ChaosGraph.pm
>>>>>>>>>>> cp lib/Bio/Chaos/FeatureUtil.pm
>>>>>>>>>>> ../blib/lib/Bio/Chaos/FeatureUtil.pm
>>>>>>>>>>> cp lib/Bio/Chaos/XSLTHelper.pm ../blib/lib/Bio/Chaos/XSLTHelper.pm
>>>>>>>>>>> cp lib/Bio/Chaos/Root.pm ../blib/lib/Bio/Chaos/Root.pm
>>>>>>>>>>> cp bin/cx-download-enscore.pl
>>>>>>>>>>> ../blib/script/cx-download-enscore.pl
>>>>>>>>>>> /usr/bin/perl -MExtUtils::MY -e 'MY->fixin(shift)' --
>>>>>>>>>>> ../blib/script/cx-download-enscore.pl
>>>>>>>>>>> cp bin/cx-genbank2chaos.pl ../blib/script/cx-genbank2chaos.pl
>>>>>>>>>>> /usr/bin/perl -MExtUtils::MY -e 'MY->fixin(shift)' --
>>>>>>>>>>> ../blib/script/cx-genbank2chaos.pl
>>>>>>>>>>> cp bin/cx-enscore2chaos.pl ../blib/script/cx-enscore2chaos.pl
>>>>>>>>>>> /usr/bin/perl -MExtUtils::MY -e 'MY->fixin(shift)' --
>>>>>>>>>>> ../blib/script/cx-enscore2chaos.pl
>>>>>>>>>>> cp bin/cx-chadoxml2chaos.pl ../blib/script/cx-chadoxml2chaos.pl
>>>>>>>>>>> /usr/bin/perl -MExtUtils::MY -e 'MY->fixin(shift)' --
>>>>>>>>>>> ../blib/script/cx-chadoxml2chaos.pl
>>>>>>>>>>> cp bin/cx-chaos-report.pl ../blib/script/cx-chaos-report.pl
>>>>>>>>>>> /usr/bin/perl -MExtUtils::MY -e 'MY->fixin(shift)' --
>>>>>>>>>>> ../blib/script/cx-chaos-report.pl
>>>>>>>>>>> Manifying ../blib/man1/cx-genbank2chaos.pl.1p
>>>>>>>>>>> Manifying ../blib/man1/cx-chadoxml2chaos.pl.1p
>>>>>>>>>>> Manifying ../blib/man1/cx-chaos-report.pl.1p
>>>>>>>>>>> Manifying ../blib/man3/Bio::Chaos::ChaosGraph.3pm
>>>>>>>>>>> Manifying ../blib/man3/Bio::Chaos::FeatureUtil.3pm
>>>>>>>>>>> Manifying ../blib/man3/Bio::Chaos::XSLTHelper.3pm
>>>>>>>>>>> Manifying ../blib/man3/Bio::Chaos::Root.3pm
>>>>>>>>>>> make[1]: Leaving directory `/home/jmalves/prog/chado/chaos-xml'
>>>>>>>>>>> make: *** No rule to make target `bin/gmod_gff2biomart5.pl',
>>>>>>>>>>> needed
>>>>>>>>>>> by
>>>>>>>>>>> `blib/script/gmod_gff2biomart5.pl'. Stop.
>>>>>>>>>>> ===========================================
>>>>>>>>>>>
>>>>>>>>>>> Scott Cain wrote:
>>>>>>>>>>>> Hello J,
>>>>>>>>>>>>
>>>>>>>>>>>> I'm cc'ing this response to the schema mailing list, which is
>>>>>>>>>>>> where
>>>>>>>>>>>> Chado discussion usually occurs. For the problem you are
>>>>>>>>>>>> describing,
>>>>>>>>>>>> there or the Apollo list (or both) would be a good place to start
>>>>>>>>>>>> when
>>>>>>>>>>>> looking for solutions.
>>>>>>>>>>>>
>>>>>>>>>>>> For using Apollo with Chado, I would suggest that you first take
>>>>>>>>>>>> a
>>>>>>>>>>>> look at the the tutorial on the GMOD website:
>>>>>>>>>>>>
>>>>>>>>>>>> http://gmod.org/wiki/Apollo_Tutorial
>>>>>>>>>>>>
>>>>>>>>>>>> Additionally, I would suggest you consider using chado checked
>>>>>>>>>>>> out
>>>>>>>>>>>> from svn instead of the 1.0 release; it is getting pretty old at
>>>>>>>>>>>> this
>>>>>>>>>>>> point. I am working on a 1.1 release that I plan to have out by
>>>>>>>>>>>> the
>>>>>>>>>>>> end of the year, but what is in svn now is quite stable.
>>>>>>>>>>>>
>>>>>>>>>>>> Scott
>>>>>>>>>>>>
>>>>>>>>>>>>
>>>>>>>>>>>> On Wed, Nov 25, 2009 at 1:23 PM, J.M.P. Alves <jmalves at vcu.edu>
>>>>>>>>>>>> wrote:
>>>>>>>>>>>>> Hi,
>>>>>>>>>>>>>
>>>>>>>>>>>>> I am following the instructions from README.Apollo in the GMOD
>>>>>>>>>>>>> 1.0
>>>>>>>>>>>>> distribution, and have found a couple of problems.
>>>>>>>>>>>>>
>>>>>>>>>>>>> When running
>>>>>>>>>>>>>
>>>>>>>>>>>>> psql chadodb < modules/sequence/apollo-bridge/apollo.inserts
>>>>>>>>>>>>>
>>>>>>>>>>>>> I got a couple of errors. The first:
>>>>>>>>>>>>>
>>>>>>>>>>>>> ERROR: null value in column "cv_id" violates not-null constraint
>>>>>>>>>>>>>
>>>>>>>>>>>>> I checked the offending part of the sql and it tries to find a
>>>>>>>>>>>>> cv_if
>>>>>>>>>>>>> for the
>>>>>>>>>>>>> record with "Relationship Ontology" as name. But in the schema I
>>>>>>>>>>>>> installed
>>>>>>>>>>>>> there is no such record. The closest I could find was one called
>>>>>>>>>>>>> "relationship" and one called "pub relationship type". Which is
>>>>>>>>>>>>> the
>>>>>>>>>>>>> correct
>>>>>>>>>>>>> one?
>>>>>>>>>>>>>
>>>>>>>>>>>>> The second error was:
>>>>>>>>>>>>>
>>>>>>>>>>>>> ERROR: aggregates not allowed in WHERE clause
>>>>>>>>>>>>>
>>>>>>>>>>>>> This was triggered by the command:
>>>>>>>>>>>>>
>>>>>>>>>>>>> delete from feature_namegenerator where
>>>>>>>>>>>>> feature_namegenerator_id
>>>>>>>>>>>>> not
>>>>>>>>>>>>> in
>>>>>>>>>>>>> (select feature_namegenerator_id from feature_namegenerator
>>>>>>>>>>>>> where
>>>>>>>>>>>>> count
>>>>>>>>>>>>> =
>>>>>>>>>>>>> max(count) group by name,type_id);
>>>>>>>>>>>>>
>>>>>>>>>>>>> I haven't figured out how to solve this one, since I have no
>>>>>>>>>>>>> experience
>>>>>>>>>>>>> with
>>>>>>>>>>>>> PostgreSQL.
>>>>>>>>>>>>>
>>>>>>>>>>>>> Regards
>>>>>>>>>>>>> J
>>>>>>>>>>>>>
>>>>>>>>>>>>>
>>>>>>>>>>>>> P.S.: I wrote a few minutes ago about a problem with GBrowse's
>>>>>>>>>>>>> Chado
>>>>>>>>>>>>> documentation. I spoke too soon, there was another problem that
>>>>>>>>>>>>> I
>>>>>>>>>>>>> found
>>>>>>>>>>>>> when
>>>>>>>>>>>>> I clicked on the examples in GBrowse (gene name). Adding the
>>>>>>>>>>>>> following
>>>>>>>>>>>>> table
>>>>>>>>>>>>> to the permissions solved it:
>>>>>>>>>>>>>
>>>>>>>>>>>>> GRANT SELECT ON all_feature_names TO "www-data";
>>>>>>>>>>>>>
>>>>>>>>>>>>> --
>>>>>>>>>>>>> -------------------------------
>>>>>>>>>>>>> João Marcelo Pereira Alves (J)
>>>>>>>>>>>>> Post-doctoral fellow
>>>>>>>>>>>>> MCV / VCU - Richmond, VA
>>>>>>>>>>>>> http://bioinfo.lpb.mic.vcu.edu
>>>>>>>>>>>>> f. 1-804-828-3897
>>>>>>>>>>>>>
>>>>>>>>>>>>>
>>>>>>>>>>> --
>>>>>>>>>>> -------------------------------
>>>>>>>>>>> João Marcelo Pereira Alves (J)
>>>>>>>>>>> Post-doctoral fellow
>>>>>>>>>>> MCV / VCU - Richmond, VA
>>>>>>>>>>> http://bioinfo.lpb.mic.vcu.edu
>>>>>>>>>>> f. 1-804-828-3897
>>>>>>>>>>>
>>>>>>>>>>>
>>>>>>>>>>>
>>>>>>>>>>>
>>>>>>>>>>>
>>>>>>>>>>>
>>>>>>>>>>> ------------------------------------------------------------------------------
>>>>>>>>>>> Join us December 9, 2009 for the Red Hat Virtual Experience,
>>>>>>>>>>> a free event focused on virtualization and cloud computing.
>>>>>>>>>>> Attend in-depth sessions from your desk. Your couch. Anywhere.
>>>>>>>>>>> http://p.sf.net/sfu/redhat-sfdev2dev
>>>>>>>>>>> _______________________________________________
>>>>>>>>>>> Gmod-schema mailing list
>>>>>>>>>>> Gmod-schema at lists.sourceforge.net
>>>>>>>>>>> https://lists.sourceforge.net/lists/listinfo/gmod-schema
>>>>>>>>>>>
>>>>>>>>> --
>>>>>>>>> -------------------------------
>>>>>>>>> João Marcelo Pereira Alves (J)
>>>>>>>>> Post-doctoral fellow
>>>>>>>>> MCV / VCU - Richmond, VA
>>>>>>>>> http://bioinfo.lpb.mic.vcu.edu
>>>>>>>>> f. 1-804-828-3897
>>>>>>>>>
>>>>>>>>>
>>>>>>>>>
>>>>>>> --
>>>>>>> -------------------------------
>>>>>>> João Marcelo Pereira Alves (J)
>>>>>>> Post-doctoral fellow
>>>>>>> MCV / VCU - Richmond, VA
>>>>>>> http://bioinfo.lpb.mic.vcu.edu
>>>>>>> f. 1-804-828-3897
>>>>>>>
>>>>>>>
>>>>>>
>>>>> --
>>>>> -------------------------------
>>>>> João Marcelo Pereira Alves (J)
>>>>> Post-doctoral fellow
>>>>> MCV / VCU - Richmond, VA
>>>>> http://bioinfo.lpb.mic.vcu.edu
>>>>> f. 1-804-828-3897
>>>>>
>>>>>
>>>>
>>>>
>> --
>> -------------------------------
>> João Marcelo Pereira Alves (J)
>> Post-doctoral fellow
>> MCV / VCU - Richmond, VA
>> http://bioinfo.lpb.mic.vcu.edu
>> f. 1-804-828-3897
>>
>>
>
>
>
--
-------------------------------
João Marcelo Pereira Alves (J)
Post-doctoral fellow
MCV / VCU - Richmond, VA
http://bioinfo.lpb.mic.vcu.edu
f. 1-804-828-3897
More information about the Gmod-help
mailing list