Blastn against Rice_genome_japonica_TIGR

Kiran Kumar kumark at cshl.edu
Wed Sep 1 10:05:28 EDT 2004


Hi Ramu,
It works for us over here. I pasted the sequence below at
http://www.gramene.org/db/searches/blast and RunBlast and it gives the
following results header followed by a detailed alignment.

chr1 : 2997635-2998018  	Alignment 	466 	8.1e-15 	1

1 hits total (1 shown)


I am guessing it could be problem with your browser. It somehow is not
able to send the sequence to the gramene_blast. Please try again and let
us know and we shall try to investigate further.

Regards,
Kiran





On Mon, 30 Aug 2004, Punna, Ramu (ICRISAT- IN) wrote:

>Dear Sir/Madam,
>
>I,Punna Ramu, working as research scholor in ICRISAT. I'm doing blast search
>of Sorghum sequences against Rice_genome_japonica_TIGR. The blastn results
>saying that it is not able to read the blast sequence. We are not able to
>find the problem from last three days. We dont know whether the problem in
>site or with us. We are giving it in Fasta Format. Can you help in this
>aspect to get the results?
>
>I'm sending you a sample of sequence.
>
>>AW679289
>TACGGCGGCCATGGGCATGGATACGGCGGCCATGGGCAGGGCTACGGCCACGCGTACCCTCCTCCGGCCGCCGCCG
>GCGCGTACCCTCCTCCGCGCACTCGGCGCACTACGGGAACATGGGATCGTACCACAGCAGCCACAGCCATGGCGGC
>GGCCACCACGGCGGCTACGGCGGCAAGCACAAGGGCGGCATGTTCGGCGGCGGCAAGTTCAGGAAGTGGAAGTGAA
>GCTGAAAGCCATCGATCGAAACTACGTATCTGCCAGCCGGCAGCCGCGTACGTACGTACGTACGTATCCTGCCAGC
>CGTAGCTAAGCATGCACTGCACACAGTTCCTATAAATAAATTAAATAAAGTAGTGCAAGCAGGCAGGACGCGTCCT
>ACGTGTATCGTTATTTGTATACGGAATAAAGTGAGACGTGTGTTTCTGGTCATGTTCATGTAACGTGCTCGGCGTA
>TGTACCACCATGCATGCAGTGTTGTATACCAGTCGTATATACAGTACAAGCCGAGTATAACCTG
>
>Thanking you sir/Madam,
>
>I look forward for your mail.
>
>Ramu.P
>




More information about the Gramene mailing list