[Gmod-help] Re: [Gmod-schema] Apollo and Chado problems
J.M.P. Alves
jmalves at vcu.edu
Thu Dec 10 17:03:18 EST 2009
OK, after quite a bit of poking around the code and DB (sorry, I'm new
to GMOD, Chado AND PostgreSQL...), I seem to have solved my problem with
the loading of sequences to the database from GFF. At least now GBrowse
is working perfectly, and Apollo can also load the sequence fine.
Here goes my solution, in case other people out there face the same
problem -- and please let me know if I'm doing it wrong...
First, the quick answer:
- after using gmod_gff_preprocessor.pl as described in the Wiki and
getting two files (one with annotations in GFF, the other with
sequence), use 'cat' to join them (I added the sorted GFF part first,
the sequence part second), like:
cat yeast.gff.sorted yeast.gff.sorted.fasta > yeast_all.gff
- upload the resulting joined file, like this:
gmod_bulk_load_gff3.pl --organism yeast --gfffile yeast_all.gff
Maybe --nosplit to the preprocessor would solve this too, but I haven't
tried.
Now, as is my bad habit, for the long answer.
I was having trouble loading the sequence when following the
instructions from http://gmod.org/wiki/Load_GFF_Into_Chado plus what the
perldoc from gmod_gff_preprocessor.pl told me:
[quote]
If the GFF3 file contains FASTA sequence at the end, the sequence will
be placed in a separate file with the extention '.fasta'. This fasta
file can be loaded separately after the split and/or
sorted GFF3 files are loaded, using the command:
gmod_bulk_load_gff3.pl -g <fasta file name>
[/quote]
Well, so that's exactly what I did, and got the ugly errors I pasted in
the earlier message.
Problem is that the current version of gmod_bulk_load_gff3.pl does NOT
seem to have a -g option for loading the sequences as described in the
preprocessor's documentation -- and as I believe GetOptions does, it is
interpreting -g as short for --gfffile.
Looking at the code, gmod_bulk_load_gff3.pl seems to create a temporary
table (tmp_gff_load_cache) during loading of the annotation that seems
to no longer exist (or contain the necessary data, at least) in a second
run of the program. I think.
Either way, joining the two files output by gmod_gff_preprocessor.pl
resulted in the sequence finally being uploaded fine.
So the documentation from both gmod_gff_preprocessor.pl and
http://gmod.org/wiki/Load_GFF_Into_Chado should be changed accordingly
when possible. Unless I'm the only bone-headed person who's interpreted
things the way I have. :-)
Cheers
J
J.M.P. Alves wrote:
> Thanks. I noticed that when I accessed GBrowse and saw the display.
>
> But another problem happened when I tried to load the sequence (file
> generated by gmod_gff3_preprocessor.pl), as listed below. I had already
> loaded the file other file generated by the preprocessor, and the only
> possibly suspicious things in the output where two skipped tables:
>
> Skipping cv table since the load file is empty...
> Loading data into analysis table ...
> Skipping organism table since the load file is empty...
>
> I'm guessing that the organism table warning is not a problem, given I
> provided the --organism option. Is the second table, cv, the problem here?
>
> The sequence file looks almost completely like a regular FASTA file,
> except for the very top, which looks like:
>
> ##FASTA
> ##FASTA
> >chrI
> CCACACCACACCCACACACCCACACACCACACCACACACCACACCACACCCACACACACACATCCTAACACTACCCTAAC
>
> ACAGCCCTAATCTAACCCTGGCCAACCTGTCTCTCAACTTACCCTCCATTACCCTGCCTCCACTCGTTACCCTGTCCCAT
>
>
> This did not happen with the previous version of the schema and GMOD
> software an general, as far as I can tell (sure did not get the error
> when loading, can't remember whether I tried to access the sequence from
> GBrowse at the time of those tests)
>
> Thanks for your help
> J
>
> ===================================================
> gmod_bulk_load_gff3.pl --organism yeast -g
> saccharomyces_cerevisiae.gff.sorted.fasta
> Preparing data for inserting into the mas_chado database
> (This may take a while ...)
> No feature found for
> CCACACCACACCCACACACCCACACACCACACCACACACCACACCACACCCACACACACACATCCTAACACTACCCTAAC,
> org_id:10 when trying to add sequence at
> /usr/local/share/perl/5.10.0/Bio/GMOD/DB/Adapter.pm line 2479, <GEN0>
> line 4.
> No feature found for chrII, org_id:10 when trying to add sequence at
> /usr/local/share/perl/5.10.0/Bio/GMOD/DB/Adapter.pm line 2479, <GEN0>
> line 5.
> No feature found for chrIII, org_id:10 when trying to add sequence at
> /usr/local/share/perl/5.10.0/Bio/GMOD/DB/Adapter.pm line 2479, <GEN0>
> line 6.
> No feature found for chrIV, org_id:10 when trying to add sequence at
> /usr/local/share/perl/5.10.0/Bio/GMOD/DB/Adapter.pm line 2479, <GEN0>
> line 7.
> No feature found for chrV, org_id:10 when trying to add sequence at
> /usr/local/share/perl/5.10.0/Bio/GMOD/DB/Adapter.pm line 2479, <GEN0>
> line 8.
> No feature found for chrVI, org_id:10 when trying to add sequence at
> /usr/local/share/perl/5.10.0/Bio/GMOD/DB/Adapter.pm line 2479, <GEN0>
> line 9.
> No feature found for chrVII, org_id:10 when trying to add sequence at
> /usr/local/share/perl/5.10.0/Bio/GMOD/DB/Adapter.pm line 2479, <GEN0>
> line 10.
> No feature found for chrVIII, org_id:10 when trying to add sequence at
> /usr/local/share/perl/5.10.0/Bio/GMOD/DB/Adapter.pm line 2479, <GEN0>
> line 11.
> No feature found for chrIX, org_id:10 when trying to add sequence at
> /usr/local/share/perl/5.10.0/Bio/GMOD/DB/Adapter.pm line 2479, <GEN0>
> line 12.
> No feature found for chrX, org_id:10 when trying to add sequence at
> /usr/local/share/perl/5.10.0/Bio/GMOD/DB/Adapter.pm line 2479, <GEN0>
> line 13.
> No feature found for chrXI, org_id:10 when trying to add sequence at
> /usr/local/share/perl/5.10.0/Bio/GMOD/DB/Adapter.pm line 2479, <GEN0>
> line 14.
> No feature found for chrXII, org_id:10 when trying to add sequence at
> /usr/local/share/perl/5.10.0/Bio/GMOD/DB/Adapter.pm line 2479, <GEN0>
> line 15.
> No feature found for chrXIII, org_id:10 when trying to add sequence at
> /usr/local/share/perl/5.10.0/Bio/GMOD/DB/Adapter.pm line 2479, <GEN0>
> line 16.
> No feature found for chrXIV, org_id:10 when trying to add sequence at
> /usr/local/share/perl/5.10.0/Bio/GMOD/DB/Adapter.pm line 2479, <GEN0>
> line 17.
> No feature found for chrXV, org_id:10 when trying to add sequence at
> /usr/local/share/perl/5.10.0/Bio/GMOD/DB/Adapter.pm line 2479, <GEN0>
> line 18.
> No feature found for chrXVI, org_id:10 when trying to add sequence at
> /usr/local/share/perl/5.10.0/Bio/GMOD/DB/Adapter.pm line 2479, <GEN0>
> line 19.
> No feature found for chrMito, org_id:10 when trying to add sequence at
> /usr/local/share/perl/5.10.0/Bio/GMOD/DB/Adapter.pm line 2479, <GEN0>
> line 20.
> No feature found for 2-micron, org_id:10 when trying to add sequence at
> /usr/local/share/perl/5.10.0/Bio/GMOD/DB/Adapter.pm line 2479, <GEN0>
> line 21.
> Skipping feature table since the load file is empty...
> Skipping featureloc table since the load file is empty...
> Skipping feature_relationship table since the load file is empty...
> Skipping featureprop table since the load file is empty...
> Skipping feature_cvterm table since the load file is empty...
> Skipping synonym table since the load file is empty...
> Skipping feature_synonym table since the load file is empty...
> Skipping dbxref table since the load file is empty...
> Skipping feature_dbxref table since the load file is empty...
> Skipping analysisfeature table since the load file is empty...
> Skipping cvterm table since the load file is empty...
> Skipping db table since the load file is empty...
> Skipping cv table since the load file is empty...
> Skipping analysis table since the load file is empty...
> Skipping organism table since the load file is empty...
> Loading sequences (if any) ...
>
> Done.
>
> While this script has made an effort to optimize the database, you
> should probably also run VACUUM FULL ANALYZE on the database as well
> commit ineffective with AutoCommit enabled at
> /usr/local/share/perl/5.10.0/Bio/GMOD/DB/Adapter.pm line 1349.
> ===================================================
>
>
>
>
> Scott Cain wrote:
>> That's not a problem. That was just introduced to the codebase within
>> the last few weeks and I need to fix it, but it is calling a commit at
>> the end of the load when it isn't needed.
>>
>> Scott
>>
>> On Thu, Dec 3, 2009 at 5:46 PM, J.M.P. Alves <jmalves at vcu.edu> wrote:
>>> Hi,
>>>
>>> At the end of loading the GFF file (using gmod_bulk_load_gff3.pl) into
>>> Chado, I get something I did not get before:
>>>
>>> commit ineffective with AutoCommit enabled
>>>
>>> Is that just a warning and the data was loaded anyway, or does it
>>> mean the
>>> commit failed? If I knew the schema better, I could check some
>>> tables, but
>>> there are so many...
>>>
>>> Thanks
>>> J
>>>
>>> Scott Cain wrote:
>>>> Hi J,
>>>>
>>>> Yes, getting schema/trunk is sufficient. Since we moved to svn pretty
>>>> recently, there are likely to be other holes in documentation where
>>>> cvs was assumed.
>>>>
>>>> As for further questions, it depends on what they are concerning. If
>>>> apollo webstart is causing you problems, you can ask about it on the
>>>> apollo mailing list, GBrowse questions to the gbrowse list, and most
>>>> other questions would go to the schema mailing list.
>>>>
>>>> Scott
>>>>
>>>> On Thu, Dec 3, 2009 at 12:15 PM, J.M.P. Alves <jmalves at vcu.edu> wrote:
>>>>> Hi,
>>>>>
>>>>> Thanks for the answer, that helped. I was following the
>>>>> instructions from
>>>>> http://gmod.org/wiki/Chado_-_Getting_Started but I missed the part
>>>>> about
>>>>> ant
>>>>> (because I was originally not installing from SVN) -- have that
>>>>> installed
>>>>> now. I didn't see anything about the checking out of the whole schema
>>>>> though.
>>>>>
>>>>> What I did was this:
>>>>>
>>>>> svn co https://gmod.svn.sourceforge.net/svnroot/gmod/schema/trunk
>>>>>
>>>>> It does check out GMODTools and other stuff. Is that sufficient? It
>>>>> did
>>>>> take
>>>>> care of all the errors at any rate.
>>>>>
>>>>> I'm now loading the ontologies into my database, and will next load
>>>>> the
>>>>> S.
>>>>> cerevisiae GFF into the DB for testing (as described at
>>>>> http://gmod.org/wiki/Load_GFF_Into_Chado).
>>>>>
>>>>> Thanks again
>>>>> J
>>>>>
>>>>> PS: quick question, I'm using the community annotation server (VMware
>>>>> image
>>>>> available from http://gmod.org/wiki/Community_Annotation_System) you
>>>>> have,
>>>>> and it's mostly working (webstarted Apollo is giving a little
>>>>> trouble). I
>>>>> do
>>>>> have some problems and questions about it though. Which list should I
>>>>> direct
>>>>> them to?
>>>>>
>>>>>
>>>>> Scott Cain wrote:
>>>>>> Hi J,
>>>>>>
>>>>>> I don't know how I missed a few emails in this thread, but the
>>>>>> problem
>>>>>> you are having is because you need to checkout the entire schema
>>>>>> repository, not just the chado subdirectory. You must have ant
>>>>>> installed, and you need to have the GMODTools directory, which is at
>>>>>> the same level as the chado directory.
>>>>>>
>>>>>> Scott
>>>>>>
>>>>>>
>>>>>> On Wed, Dec 2, 2009 at 4:11 PM, J.M.P. Alves <jmalves at vcu.edu> wrote:
>>>>>>> Hi, Dave
>>>>>>>
>>>>>>> Thanks, that did help -- although the two lines you mention were
>>>>>>> *already*
>>>>>>> commented out. I also had to comment out the following:
>>>>>>>
>>>>>>> if ($ant or !-e "$working_dir/../GMODTools") {
>>>>>>> push @exe_files, 'bin/gmod_bulkfiles.pl',
>>>>>>> 'bin/gmod_gff2biomart5.pl';
>>>>>>> }
>>>>>>>
>>>>>>> These are currently lines 493-5 of Makefile.PL
>>>>>>>
>>>>>>> After that, it did finish without problems, apparently.
>>>>>>>
>>>>>>> I am currently updating from the gmod-1.0 file found on
>>>>>>> SourceForge to
>>>>>>> the
>>>>>>> SVN code. Do I need to uninstall the old version (how? 'make
>>>>>>> uninstall'
>>>>>>> does
>>>>>>> not do it, just gives a list of things to delete) or is just
>>>>>>> installing
>>>>>>> on
>>>>>>> top of the one I have right now fine?
>>>>>>>
>>>>>>> Thanks
>>>>>>> J
>>>>>>>
>>>>>>> Dave Clements, GMOD Help Desk wrote:
>>>>>>>> Hi J,
>>>>>>>>
>>>>>>>> We generally recommend searching using Nabble:
>>>>>>>>
>>>>>>>> http://www.nabble.com/Generic-Model-Organism-System-Database-f3491.html
>>>>>>>>
>>>>>>>>
>>>>>>>> And, using Nabble, I found a thread from 2007
>>>>>>>>
>>>>>>>>
>>>>>>>> (http://old.nabble.com/Blast-input-file-for-CHADO-to9828403.html#a9847174)
>>>>>>>>
>>>>>>>> where someone had the same problem. I have no idea why you are
>>>>>>>> having
>>>>>>>> the problem, but a workaround is:
>>>>>>>>
>>>>>>>> But, it works after commenting out the following lines in
>>>>>>>> Makefile.PL.
>>>>>>>> #'bin/gmod_bulkfiles.pl', line no 522
>>>>>>>> #'bin/gmod_gff2biomart5.pl', line no 523
>>>>>>>>
>>>>>>>> You don't need the biomart script unless you are using BioMart too.
>>>>>>>> Does that work for you?
>>>>>>>>
>>>>>>>> Dave C.
>>>>>>>>
>>>>>>>> On Mon, Nov 30, 2009 at 1:44 PM, J.M.P. Alves <jmalves at vcu.edu>
>>>>>>>> wrote:
>>>>>>>>> Thanks, Scott
>>>>>>>>>
>>>>>>>>> I just subscribed to the list. BTW, is there a way to search it? I
>>>>>>>>> looked there, but the Sourceforge interface is terrible, and the
>>>>>>>>> search
>>>>>>>>> box on the top right searches all the site's project names
>>>>>>>>> instead of
>>>>>>>>> the list archives.
>>>>>>>>>
>>>>>>>>> I ask because, following your advice, I checked out the svn
>>>>>>>>> version.
>>>>>>>>> Then I got a warning during perl Makefile.PL that the kit was
>>>>>>>>> missing
>>>>>>>>> files, contact author:
>>>>>>>>>
>>>>>>>>> ===========================================
>>>>>>>>> Checking if your kit is complete...
>>>>>>>>> Warning: the following files are missing in your kit:
>>>>>>>>> bin/cxgn/load_cvterms.pl
>>>>>>>>> bin/gmod_bulkfiles.pl
>>>>>>>>> bin/gmod_gff2biomart5.pl
>>>>>>>>> conf/bulkfiles/anogam.xml
>>>>>>>>> conf/bulkfiles/blastfiles.xml
>>>>>>>>> conf/bulkfiles/bulkfiles_template.xml
>>>>>>>>> conf/bulkfiles/chadofeatconv.xml
>>>>>>>>> conf/bulkfiles/chadofeatsql.xml
>>>>>>>>> conf/bulkfiles/chadogenepagesql.xml
>>>>>>>>> conf/bulkfiles/dmelhetfeatconv.xml
>>>>>>>>> conf/bulkfiles/dmelr420.xml
>>>>>>>>> conf/bulkfiles/dmelr430.xml
>>>>>>>>> conf/bulkfiles/dpsebulk-p4.xml
>>>>>>>>> conf/bulkfiles/dpsebulk-p5.xml
>>>>>>>>> conf/bulkfiles/dpsebulk-r2.xml
>>>>>>>>> conf/bulkfiles/drosmelgb.xml
>>>>>>>>> conf/bulkfiles/fastawriter.xml
>>>>>>>>> conf/bulkfiles/fbbulk-hetr3.xml
>>>>>>>>> conf/bulkfiles/fbbulk-r3.xml
>>>>>>>>> conf/bulkfiles/fbbulk-r3h.xml
>>>>>>>>> conf/bulkfiles/fbbulk-r4.xml
>>>>>>>>> conf/bulkfiles/fbbulk-r41.xml
>>>>>>>>> conf/bulkfiles/fbbulk-r411.xml
>>>>>>>>> conf/bulkfiles/fbreleases.xml
>>>>>>>>> conf/bulkfiles/featuresets.xml
>>>>>>>>> conf/bulkfiles/filesets.xml
>>>>>>>>> conf/bulkfiles/gbrowseconf.xml
>>>>>>>>> conf/bulkfiles/gbrowseconf_fb.xml
>>>>>>>>> conf/bulkfiles/genbanksubmit.xml
>>>>>>>>> conf/bulkfiles/genomeweb.xml
>>>>>>>>> conf/bulkfiles/organisms.xml
>>>>>>>>> conf/bulkfiles/sgdbulk.xml
>>>>>>>>> conf/bulkfiles/sgdbulk1.xml
>>>>>>>>> conf/bulkfiles/sgdfeatconf.xml
>>>>>>>>> conf/bulkfiles/site_defaults.xml
>>>>>>>>> conf/bulkfiles/site_eugenes_defaults.xml
>>>>>>>>> conf/bulkfiles/spbase.xml
>>>>>>>>> conf/bulkfiles/spbasefeatconf.xml
>>>>>>>>> conf/bulkfiles/tablewriter.xml
>>>>>>>>> conf/bulkfiles/toacode.xml
>>>>>>>>> conf/bulkfiles/tognomap.xml
>>>>>>>>> conf/chado2apollo-apache.conf
>>>>>>>>> doc/about-gff2biomart.pod
>>>>>>>>> doc/COPYRIGHT
>>>>>>>>> doc/gff2biomart-update.note
>>>>>>>>> doc/gmod-tools-readme.pod
>>>>>>>>> lib/Bio/GMOD/Bulkfiles.pm
>>>>>>>>> lib/Bio/GMOD/Bulkfiles/AcodeWriter.pm
>>>>>>>>> lib/Bio/GMOD/Bulkfiles/BlastWriter.pm
>>>>>>>>> lib/Bio/GMOD/Bulkfiles/BulkWriter.pm
>>>>>>>>> lib/Bio/GMOD/Bulkfiles/FastaWriter.pm
>>>>>>>>> lib/Bio/GMOD/Bulkfiles/FeatureWriter.pm
>>>>>>>>> lib/Bio/GMOD/Bulkfiles/GenbankSubmitWriter.pm
>>>>>>>>> lib/Bio/GMOD/Bulkfiles/GnomapWriter.pm
>>>>>>>>> lib/Bio/GMOD/Bulkfiles/MyLargePrimarySeq.pm
>>>>>>>>> lib/Bio/GMOD/Bulkfiles/MySplitLocation.pm
>>>>>>>>> lib/Bio/GMOD/Bulkfiles/SWISS_CRC64.pm
>>>>>>>>> lib/Bio/GMOD/Bulkfiles/TableWriter.pm
>>>>>>>>> lib/Bio/GMOD/Config2.pm
>>>>>>>>> lib/Bio/GMOD/SeqUtils.pm
>>>>>>>>> Please inform the author.
>>>>>>>>> ===========================================
>>>>>>>>>
>>>>>>>>> When I "make", it finishes quite early, with:
>>>>>>>>>
>>>>>>>>> make: *** No rule to make target `bin/gmod_gff2biomart5.pl',
>>>>>>>>> needed
>>>>>>>>> by
>>>>>>>>> `blib/script/gmod_gff2biomart5.pl'. Stop.
>>>>>>>>>
>>>>>>>>> (the full output of "make" is below)
>>>>>>>>>
>>>>>>>>> Has anyone seen this problem? Is it a problem? (it seems to me...)
>>>>>>>>> And
>>>>>>>>> any idea what to do, please?
>>>>>>>>>
>>>>>>>>> Thanks
>>>>>>>>> J
>>>>>>>>>
>>>>>>>>> ===========================================
>>>>>>>>> ~/prog/chado$ make
>>>>>>>>> Skip blib/lib/Bio/GMOD/Load.pm (unchanged)
>>>>>>>>> Skip blib/lib/Bio/FeatureIO/chado.pm (unchanged)
>>>>>>>>> Skip blib/lib/Bio/GMOD/DB/Config.pm (unchanged)
>>>>>>>>> Skip blib/lib/Bio/Chado/Config.pm (unchanged)
>>>>>>>>> Skip blib/lib/Bio/Chado/LoadDBI.pm (unchanged)
>>>>>>>>> Skip blib/lib/Bio/GMOD/Load/GFF.pm (unchanged)
>>>>>>>>> Skip blib/lib/Bio/GMOD/Config.pm (unchanged)
>>>>>>>>> Skip blib/lib/Bio/FeatureIO/chadobulk.pm (unchanged)
>>>>>>>>> Skip blib/lib/Bio/GMOD/DB/Adapter.pm (unchanged)
>>>>>>>>> Skip blib/lib/Bio/GMOD/DB/Adapter/Wormbase.pm (unchanged)
>>>>>>>>> Skip blib/lib/Bio/Chado/AutoDBI.pm (unchanged)
>>>>>>>>> Skip blib/lib/Bio/GMOD/DB/Adapter/FeatureIterator.pm (unchanged)
>>>>>>>>> Skip blib/lib/Bio/GMOD/DB/Tools/ETA.pm (unchanged)
>>>>>>>>> Skip blib/lib/Bio/Chado/Builder.pm (unchanged)
>>>>>>>>> make[1]: Entering directory `/home/jmalves/prog/chado/chaos-xml'
>>>>>>>>> cp lib/Bio/Chaos/ChaosGraph.pm ../blib/lib/Bio/Chaos/ChaosGraph.pm
>>>>>>>>> cp lib/Bio/Chaos/FeatureUtil.pm
>>>>>>>>> ../blib/lib/Bio/Chaos/FeatureUtil.pm
>>>>>>>>> cp lib/Bio/Chaos/XSLTHelper.pm ../blib/lib/Bio/Chaos/XSLTHelper.pm
>>>>>>>>> cp lib/Bio/Chaos/Root.pm ../blib/lib/Bio/Chaos/Root.pm
>>>>>>>>> cp bin/cx-download-enscore.pl
>>>>>>>>> ../blib/script/cx-download-enscore.pl
>>>>>>>>> /usr/bin/perl -MExtUtils::MY -e 'MY->fixin(shift)' --
>>>>>>>>> ../blib/script/cx-download-enscore.pl
>>>>>>>>> cp bin/cx-genbank2chaos.pl ../blib/script/cx-genbank2chaos.pl
>>>>>>>>> /usr/bin/perl -MExtUtils::MY -e 'MY->fixin(shift)' --
>>>>>>>>> ../blib/script/cx-genbank2chaos.pl
>>>>>>>>> cp bin/cx-enscore2chaos.pl ../blib/script/cx-enscore2chaos.pl
>>>>>>>>> /usr/bin/perl -MExtUtils::MY -e 'MY->fixin(shift)' --
>>>>>>>>> ../blib/script/cx-enscore2chaos.pl
>>>>>>>>> cp bin/cx-chadoxml2chaos.pl ../blib/script/cx-chadoxml2chaos.pl
>>>>>>>>> /usr/bin/perl -MExtUtils::MY -e 'MY->fixin(shift)' --
>>>>>>>>> ../blib/script/cx-chadoxml2chaos.pl
>>>>>>>>> cp bin/cx-chaos-report.pl ../blib/script/cx-chaos-report.pl
>>>>>>>>> /usr/bin/perl -MExtUtils::MY -e 'MY->fixin(shift)' --
>>>>>>>>> ../blib/script/cx-chaos-report.pl
>>>>>>>>> Manifying ../blib/man1/cx-genbank2chaos.pl.1p
>>>>>>>>> Manifying ../blib/man1/cx-chadoxml2chaos.pl.1p
>>>>>>>>> Manifying ../blib/man1/cx-chaos-report.pl.1p
>>>>>>>>> Manifying ../blib/man3/Bio::Chaos::ChaosGraph.3pm
>>>>>>>>> Manifying ../blib/man3/Bio::Chaos::FeatureUtil.3pm
>>>>>>>>> Manifying ../blib/man3/Bio::Chaos::XSLTHelper.3pm
>>>>>>>>> Manifying ../blib/man3/Bio::Chaos::Root.3pm
>>>>>>>>> make[1]: Leaving directory `/home/jmalves/prog/chado/chaos-xml'
>>>>>>>>> make: *** No rule to make target `bin/gmod_gff2biomart5.pl',
>>>>>>>>> needed
>>>>>>>>> by
>>>>>>>>> `blib/script/gmod_gff2biomart5.pl'. Stop.
>>>>>>>>> ===========================================
>>>>>>>>>
>>>>>>>>> Scott Cain wrote:
>>>>>>>>>> Hello J,
>>>>>>>>>>
>>>>>>>>>> I'm cc'ing this response to the schema mailing list, which is
>>>>>>>>>> where
>>>>>>>>>> Chado discussion usually occurs. For the problem you are
>>>>>>>>>> describing,
>>>>>>>>>> there or the Apollo list (or both) would be a good place to start
>>>>>>>>>> when
>>>>>>>>>> looking for solutions.
>>>>>>>>>>
>>>>>>>>>> For using Apollo with Chado, I would suggest that you first
>>>>>>>>>> take a
>>>>>>>>>> look at the the tutorial on the GMOD website:
>>>>>>>>>>
>>>>>>>>>> http://gmod.org/wiki/Apollo_Tutorial
>>>>>>>>>>
>>>>>>>>>> Additionally, I would suggest you consider using chado checked
>>>>>>>>>> out
>>>>>>>>>> from svn instead of the 1.0 release; it is getting pretty old at
>>>>>>>>>> this
>>>>>>>>>> point. I am working on a 1.1 release that I plan to have out
>>>>>>>>>> by the
>>>>>>>>>> end of the year, but what is in svn now is quite stable.
>>>>>>>>>>
>>>>>>>>>> Scott
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>>>> On Wed, Nov 25, 2009 at 1:23 PM, J.M.P. Alves <jmalves at vcu.edu>
>>>>>>>>>> wrote:
>>>>>>>>>>> Hi,
>>>>>>>>>>>
>>>>>>>>>>> I am following the instructions from README.Apollo in the
>>>>>>>>>>> GMOD 1.0
>>>>>>>>>>> distribution, and have found a couple of problems.
>>>>>>>>>>>
>>>>>>>>>>> When running
>>>>>>>>>>>
>>>>>>>>>>> psql chadodb < modules/sequence/apollo-bridge/apollo.inserts
>>>>>>>>>>>
>>>>>>>>>>> I got a couple of errors. The first:
>>>>>>>>>>>
>>>>>>>>>>> ERROR: null value in column "cv_id" violates not-null constraint
>>>>>>>>>>>
>>>>>>>>>>> I checked the offending part of the sql and it tries to find a
>>>>>>>>>>> cv_if
>>>>>>>>>>> for the
>>>>>>>>>>> record with "Relationship Ontology" as name. But in the schema I
>>>>>>>>>>> installed
>>>>>>>>>>> there is no such record. The closest I could find was one called
>>>>>>>>>>> "relationship" and one called "pub relationship type". Which
>>>>>>>>>>> is the
>>>>>>>>>>> correct
>>>>>>>>>>> one?
>>>>>>>>>>>
>>>>>>>>>>> The second error was:
>>>>>>>>>>>
>>>>>>>>>>> ERROR: aggregates not allowed in WHERE clause
>>>>>>>>>>>
>>>>>>>>>>> This was triggered by the command:
>>>>>>>>>>>
>>>>>>>>>>> delete from feature_namegenerator where
>>>>>>>>>>> feature_namegenerator_id
>>>>>>>>>>> not
>>>>>>>>>>> in
>>>>>>>>>>> (select feature_namegenerator_id from feature_namegenerator
>>>>>>>>>>> where
>>>>>>>>>>> count
>>>>>>>>>>> =
>>>>>>>>>>> max(count) group by name,type_id);
>>>>>>>>>>>
>>>>>>>>>>> I haven't figured out how to solve this one, since I have no
>>>>>>>>>>> experience
>>>>>>>>>>> with
>>>>>>>>>>> PostgreSQL.
>>>>>>>>>>>
>>>>>>>>>>> Regards
>>>>>>>>>>> J
>>>>>>>>>>>
>>>>>>>>>>>
>>>>>>>>>>> P.S.: I wrote a few minutes ago about a problem with GBrowse's
>>>>>>>>>>> Chado
>>>>>>>>>>> documentation. I spoke too soon, there was another problem
>>>>>>>>>>> that I
>>>>>>>>>>> found
>>>>>>>>>>> when
>>>>>>>>>>> I clicked on the examples in GBrowse (gene name). Adding the
>>>>>>>>>>> following
>>>>>>>>>>> table
>>>>>>>>>>> to the permissions solved it:
>>>>>>>>>>>
>>>>>>>>>>> GRANT SELECT ON all_feature_names TO "www-data";
>>>>>>>>>>>
>>>>>>>>>>> --
>>>>>>>>>>> -------------------------------
>>>>>>>>>>> João Marcelo Pereira Alves (J)
>>>>>>>>>>> Post-doctoral fellow
>>>>>>>>>>> MCV / VCU - Richmond, VA
>>>>>>>>>>> http://bioinfo.lpb.mic.vcu.edu
>>>>>>>>>>> f. 1-804-828-3897
>>>>>>>>>>>
>>>>>>>>>>>
>>>>>>>>> --
>>>>>>>>> -------------------------------
>>>>>>>>> João Marcelo Pereira Alves (J)
>>>>>>>>> Post-doctoral fellow
>>>>>>>>> MCV / VCU - Richmond, VA
>>>>>>>>> http://bioinfo.lpb.mic.vcu.edu
>>>>>>>>> f. 1-804-828-3897
>>>>>>>>>
>>>>>>>>>
>>>>>>>>>
>>>>>>>>>
>>>>>>>>>
>>>>>>>>> ------------------------------------------------------------------------------
>>>>>>>>>
>>>>>>>>> Join us December 9, 2009 for the Red Hat Virtual Experience,
>>>>>>>>> a free event focused on virtualization and cloud computing.
>>>>>>>>> Attend in-depth sessions from your desk. Your couch. Anywhere.
>>>>>>>>> http://p.sf.net/sfu/redhat-sfdev2dev
>>>>>>>>> _______________________________________________
>>>>>>>>> Gmod-schema mailing list
>>>>>>>>> Gmod-schema at lists.sourceforge.net
>>>>>>>>> https://lists.sourceforge.net/lists/listinfo/gmod-schema
>>>>>>>>>
>>>>>>> --
>>>>>>> -------------------------------
>>>>>>> João Marcelo Pereira Alves (J)
>>>>>>> Post-doctoral fellow
>>>>>>> MCV / VCU - Richmond, VA
>>>>>>> http://bioinfo.lpb.mic.vcu.edu
>>>>>>> f. 1-804-828-3897
>>>>>>>
>>>>>>>
>>>>>>>
>>>>>>
>>>>> --
>>>>> -------------------------------
>>>>> João Marcelo Pereira Alves (J)
>>>>> Post-doctoral fellow
>>>>> MCV / VCU - Richmond, VA
>>>>> http://bioinfo.lpb.mic.vcu.edu
>>>>> f. 1-804-828-3897
>>>>>
>>>>>
>>>>
>>>>
>>> --
>>> -------------------------------
>>> João Marcelo Pereira Alves (J)
>>> Post-doctoral fellow
>>> MCV / VCU - Richmond, VA
>>> http://bioinfo.lpb.mic.vcu.edu
>>> f. 1-804-828-3897
>>>
>>>
>>
>>
>>
>
--
-------------------------------
João Marcelo Pereira Alves (J)
Post-doctoral fellow
MCV / VCU - Richmond, VA
http://bioinfo.lpb.mic.vcu.edu
f. 1-804-828-3897
More information about the Gmod-help
mailing list